barSeed - Barley Seed Development Database

Probe CUST_25042_PI390587928

Source Contig U35_38676

barSeed

Links

Probe Details

Probe ID	Chip	Probe Sequence (60 bp)	Probe location	Differentially Expressed
CUST_25042_PI390587928	Hv_44K_v2	AAGATGTCCCACAATGGAGGAGATGTCCCACGCCACCAAGAACTTCAGCGACGCCAACCT	503	GeneList: None MasterList: None

Probe Values

This probe has no recorded values for this experiment

Probe Sequence's BLAST hits in Barley Unigene Datasets

Dataset	Hit	Hit Length	E-value	Position on Hit	% Identity	Match	Direction	Probes on Sequence
MLOC	MLOC_75746.16	2685	2e-24	505 - 564	100	60 / 60	plus	None
MLOC	MLOC_75746.5	2139	2e-24	568 - 627	100	60 / 60	plus	None
MLOC	MLOC_75746.6	2492	2e-24	568 - 627	100	60 / 60	plus	None
MLOC	MLOC_75746.11	2711	2e-24	545 - 604	100	60 / 60	plus	ABC30617
MLOC	MLOC_75746.10	2487	2e-24	545 - 604	100	60 / 60	plus	ABC30617
MLOC	MLOC_75746.4	2217	2e-24	570 - 629	100	60 / 60	plus	None
MLOC	MLOC_75746.3	2274	2e-24	852 - 911	100	60 / 60	plus	None
MLOC	MLOC_75746.1	3893	2e-24	852 - 911	100	60 / 60	plus	ABC30617
MLOC	MLOC_75746.14	1963	2e-24	543 - 602	100	60 / 60	plus	None
MLOC	MLOC_75746.15	1836	2e-24	543 - 602	100	60 / 60	plus	ABC30617
MLOC	MLOC_75746.9	3279	2e-24	545 - 604	100	60 / 60	plus	None
MLOC	MLOC_75746.2	3238	2e-24	852 - 911	100	60 / 60	plus	ABC30617
MLOC	MLOC_75746.12	2698	2e-24	545 - 604	100	60 / 60	plus	None
MLOC	MLOC_75746.7	2971	2e-24	558 - 617	100	60 / 60	plus	ABC30617
MLOC	MLOC_75746.13	2039	2e-24	545 - 604	100	60 / 60	plus	None
MLOC	MLOC_75746.8	3266	2e-24	558 - 617	100	60 / 60	plus	ABC30617
JLOC1	JLOC1_50525.13	2595	8e-25	545 - 604	100	60 / 60	plus
JLOC1	JLOC1_50525.12	2680	8e-25	545 - 604	100	60 / 60	plus
JLOC1	JLOC1_50525.11	1608	8e-25	545 - 604	100	60 / 60	plus
JLOC1	JLOC1_50525.10	3250	8e-25	545 - 604	100	60 / 60	plus
JLOC1	JLOC1_50525.9	3335	8e-25	545 - 604	100	60 / 60	plus
JLOC1	JLOC1_50525.8	2838	8e-25	545 - 604	100	60 / 60	plus
JLOC1	JLOC1_50525.7	2032	8e-25	545 - 604	100	60 / 60	plus
JLOC1	JLOC1_50525.6	2536	8e-25	545 - 604	100	60 / 60	plus
JLOC1	JLOC1_50525.5	2021	8e-25	545 - 604	100	60 / 60	plus
JLOC1	JLOC1_50525.4	3728	8e-25	545 - 604	100	60 / 60	plus
JLOC1	JLOC1_50525.3	2479	8e-25	555 - 614	100	60 / 60	plus
JLOC1	JLOC1_50525.2	2461	8e-25	555 - 614	100	60 / 60	plus
JLOC1	JLOC1_50525.1	2976	8e-25	555 - 614	100	60 / 60	plus
Harvest21	ABC34562	611	3e-25	504 - 563	100	60 / 60	plus
Harvest35	U35_38676	611	3e-25	504 - 563	100	60 / 60	plus

Contig Sequence (611 bp)

>U35_38676 611 Hv_44K_v2
GCTCGCCTCCTCTCTCTCCTGTTTGACTCACTTGCCGCCGCCACCTCTCTCCCTCGCTGC
CATCCACCACCCATGCCGGCTAGTTTCGGCGAGCTCCGGTGGCGCGCATCACGCCCCCGG
GTGCCCATAGGTCCGCGCCTCCTTCCCTTCCGACCAGAATCGGCGCTCAAGCTGTCCACC
CCTCCCATGGCTAGCTAGGGTTTCGGCCGCCACAATTAACTTGGCCGGGATCCGCCACAT
TCGGCGTCGGCGAGGCATGCGGGCGCCAGATCTGGCACTGGCGTGGCCCAAGTTGGTCCC
TCTCCTCCTTGTTTGCCCCACCCTCTTCTCCCCATCTCCCCTCCCCCTACCTCCCAGATC
CCAGCTCTCGCTCAATGCAGATGCTCGCACCGACCGACTCGATGGATCGCATCGACCATG
CGCGGAGCCGCCTCGCGGTGCTCTCTTCCCACCTCCTCGGCGCCGGCGTCGAGGGCTTGT
CTTCTGTGCGAGGCTGTGCACAGAAGATGTCCCACAATGGAGGAGATGTCCCACGCCACC
AAGAACTTCAGCGACGCCAACCTCGTCGGCGTCGGCACCTTCGGCAAGGTCTACATGGGC
CTCCTGCTCGA

Homology of Contig U35_38676 to Model Species (E-value threshold 1e-50)

Pseudo-peptide dataset	Hit	Hit length	E-value	Description
Rice v7	None
Brachypodium v1_2	None
Arabidopsis v10	None