- Primer Hv197
Location of Primer Pair Hv197
Primer Pair Details
Gene Name | HvIPM |
---|---|
Gene Description | interacts with PIEPPPHH; required for both leaf adaxial?abaxial polarity formation |
Chromosome | chr2H |
Forward Primer Start | 698441676 |
Forward Primer End | 698441696 |
Reverse Primer Start | 698442010 |
Reverse Primer End | 698442030 |
Forward Primer Sequence | GGGCCGAGGCCTAGCAGCGG |
Reverse Primer Sequence | GTCTTCTGGTGCCTGACGGG |