- Primer Hv131
Location of Primer Pair Hv131
Primer Pair Details
Gene Name | Hv26Si |
---|---|
Gene Description | non-ATPase subunit of the 26S proteasome with multiubiquitin-chain-binding capabilities |
Chromosome | chr4H |
Forward Primer Start | 534646079 |
Forward Primer End | 534646099 |
Reverse Primer Start | 534644969 |
Reverse Primer End | 534644989 |
Forward Primer Sequence | GGCGTCTGGTCAATCTGATATG |
Reverse Primer Sequence | GTAAAAGCAGCTAATGCAGG |