Probe CUST_1363_PI426222305 - General Information
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_1363_PI426222305 | JHI_St_60k_v1 | DMT400090346 | GGTGGTACATCAGAAAAAGTTGTTGGACAAATAATTGAAATGCTCAAGCTCAAAGTTTGA |
All Microarray Probes Designed to Gene DMG400039917
Probe ID | Chip name | Transcript ID | Probe Sequence |
---|---|---|---|
CUST_1363_PI426222305 | JHI_St_60k_v1 | DMT400090346 | GGTGGTACATCAGAAAAAGTTGTTGGACAAATAATTGAAATGCTCAAGCTCAAAGTTTGA |
Microarray Signals from CUST_1363_PI426222305
Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
---|---|---|---|---|
Control 1h | 130.791 | 14.7975 | 2.24637 | 0.148931 |
ABA 1h | 39.3256 | 9.05438 | 0.73506 | 0.210415 |
ACC 1h | 109.997 | 48.7481 | 1.54141 | 0.624723 |
BABA 1h | 31.3778 | 4.33774 | 0.554911 | 0.121823 |
Chitin 1h | 17.8754 | 4.54059 | 0.322652 | 0.0785755 |
Epi 1h | 53.9734 | 4.96735 | 1.07521 | 0.0942871 |
SA 1h | 30.7315 | 6.98983 | 0.489071 | 0.160442 |
Me-JA 1h | 10.2662 | 3.89368 | 0.197812 | 0.0926609 |
Control 6h | 192.323 | 57.5325 | 3.03602 | 0.768962 |
ABA 6h | 13.2432 | 4.21357 | 0.195042 | 0.0775402 |
ACC 6h | 69.3096 | 17.7641 | 0.978157 | 0.198179 |
BABA 6h | 80.5236 | 25.4401 | 1.12613 | 0.365 |
Chitin 6h | 75.8602 | 14.2412 | 1.19583 | 0.25422 |
Epi 6h | 143.617 | 45.085 | 2.00895 | 0.874253 |
SA 6h | 93.2973 | 17.0851 | 1.58827 | 0.31337 |
Me-JA 6h | 36.1198 | 17.41 | 0.443608 | 0.408971 |
Source Transcript PGSC0003DMT400090346 - Homology to Model Species (BLASTX to E-value < 1e-50)
Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
---|---|---|---|---|---|---|
Tomato (ITAG) | Solyc02g088500.1 | +1 | 2e-98 | 306 | 196/447 (44%) | evidence_code:10F0H1E1IEG genomic_reference:SL2.50ch02 gene_region:45151406-45152794 transcript_region:SL2.50ch02:45151406..45152794- go_terms:GO:0080043 functional_description:C-glucosyltransferase (AHRD V1 **** C3W7B0_ORYSJ); contains Interpro domain(s) IPR002213 UDP-glucuronosyl/UDP-glucosyltransferase |
TAIR PP10 | AT3G16520.3 | +1 | 6e-44 | 161 | 115/389 (30%) | UDP-glucosyl transferase 88A1 | chr3:5619355-5620833 REVERSE LENGTH=462 |